Homologous vs Analogous Traits

Homologous Traits

The beaver is a semi-aquatic, broad-tailed mammal native to North America and Eurasia that builds dams for protection from predators and for easier access and storage of food. The elephant is the largest land mammal that is native to Africa and Asia; elephants are highly intelligent and live in matriarchs in which every year the oldest female leads the herd across many miles to the water sources that she remembers.

The teeth of a beaver and the tusks of an elephant are homologous traits because they are related features that have evolved from a common ancestor. Although they appear to be different structures they are both evolved from the incisor teeth that they shared in their common ancestor. Beaver teeth and elephant tusks have changed over time to perform different functions but they are both considered to be the incisor teeth in either animal.

Beaver teeth never stop growing and get continuously filed down as they get used throughout their lifespan. They mainly function to chew down trees for building dams and lodges. Elephant tusks also grow continuously and are used for digging, fighting, and carving tree bark for food. 

The common ancestor between the beaver and the elephant is believed to be Juramaia, a small, furry rodent that survived the apocalypse that killed the dinosaurs. This rodent has also been hypothesized to be the common ancestor to all mammals.

Analogous Traits

The octopus is a squishy invertebrate creature that has two eyes, three hearts and eight limbs, and lives deep in the ocean. The human is a vertebrate that lives completely on land and has two eyes, one heart, two arms and walks upright on two legs.

The eyes of the octopus and the eyes of a human are an analogous trait that is shared by both species but they evolved independently from each other out of the necessity for vision.

The anatomy of the human and octopus eyes may appear similar but function very differently. The human eye focuses on an object by changing the shape of the lens with the eye muscles, while the octopus protracts and retracts the lens to and from the retina, like a camera-lens. The nervous and cellular functions are also completely backwards and opposite between humans and the octopus, but it has to do with the fact that we evolved to see through air, and octopuses evolved to see through water, resulting in completely different types of eyes.

Our species is so different from the octopus that we may not appear related at all but somewhere in the timeline of evolution, we all still had to have shared the same common ancestor. The reason that the trait for eyes between humans and octopuses is analogous is because our common ancestor had not yet evolved eyes until after the evolutionary split occurred in the family tree. One branch that led to humans and the other that led to octopuses and somewhere in between the eyes evolved independently as a means of the necessity to survive, or in other words, from natural selection.

DNA

TACCACGTAAACGTTAATACGTATCACGCAAACGCTATGACCTTTATC

Charles Lyell

1. Of the five individuals listed I would argue that Charles Lyell had the most influenced over Darwin’s development of Natural Selection. Darwin’s idea that every adaptation for species survival were only passed on by random chance and over a uniform period of time was greatly inspired by the studies that Charles Lyell had already published.

2. http://www.pbs.org/wgbh/evolution/library/02/4/l_024_01.html
According to PBS, Charles Lyell's book Principles of Geology was the most important science book of all time. If you think about it, his observations and ideas about the slow and uniform growth of mountains was what inspired Charles Darwin to develop his theory of evolution as also a slow and uniform process in species. If Charles Lyell's book inspired Charles Darwin to come up with his theory then it definitely earns its title as "the most important scientific book ever."

3. The bullet point that most fits Lyell's positive influence for Darwin's theory of evolution must be the one that says "Individuals do not evolve. Populations do." According to PBS, Darwin applied what he learned from Lyell's geologic studies and realized that, like the valleys and mountains of the earth's crust, species also either evolve gradually or die out gradually.

4. Darwin probably could have come up with his theory of natural selection all by himself but he would have had to study geology to the extent as Lyell did so that he could be able to imagine how long it actually takes for evolution to occur, like how mountains grow only 10 inches in a whole decade, it is hard to imagine without that kind of comparison.

5. Darwin was a faithful person but he was also a scientist compelled to find the truth about his origins. He must have felt pressured to break it gently to the religious folks (which was everybody) but he needed to publish his findings as truthful as possible anyway. The church in those times was completely unforgiving because they had so much power, and Darwin was one among a quite a few just trying to find the truth.