Language Blog

In communicating with my mom and older brother it was really entertaining because my brother liked to take over the conversation and interrupt my mom most of the time (but we are used to that). In my family, communication is already pretty frustrating because we all have kind of strong personalities, so when I asked them to participate in this assignment I had already predicted it would not go too smoothly. Overall it was amusing because every time I felt the urge to speak I noticed that I would exaggerate my expressions to try to regain control of the conversation. I did have to break character a few times as I had to yell at my brother to take the experiment more seriously, but we would only end up laughing every time he got the best of me. I realized that without words I had absolutely no control of the conversation especially when my mom would try her best to guess what I was saying, my brother would yell out random guesses that had absolutely nothing to do with my expressions and the topic would have to change yet again at his will. Even though this experiment was an easy opportunity for my brother to be his usual obnoxious self, I was able to empathize with those that struggle with communication, like the deaf and the mute. If I can't even stand to stay quiet for an entire 20 minutes of a conversation, I can't imagine what it would be like to be born without the ability to speak at all.

Any culture that is able to communicate with words and complex language is hands down at an advantage over the culture that cannot. During high school I had a friend who studied American Sign Language and she could also speak normally. She enjoyed being a translator for deaf-mute students and she told me how complex ideas are communicated more simply in ASL. From what I remember, her example was that in regular language the statement "you are fatter" would be perceived as rude but in ASL, the fact that they use less "words" to communicate, that same phrase would be pretty much the best way to tell someone that they look like they have "gained some weight."

The second part of the experiment was so much easier to do because I was finally allowed to use my words and we didn't all feel anchored to each other anymore like we did in the first part of the assignment. I was able to follow my mom and brother around and it was easier to keep their attention on me, so that let me feel like I was more in control. This part of the assignment was kind of contagious because then my mom and brother would also try speaking in monotone with me and sometimes we found it difficult to tell when we were joking or being serious. Sometimes, we were unable to differentiate when a sentence was actually a question or a statement, because in monotone the voice pitch stays neutral even at the end of a question, so it sounds like a regular sentence. I found it relatively easy to keep my facial expressions still as I spoke but it felt like I was multitasking the entire time and I had to constantly remember not to move my eyebrows or my cheeks as I spoke. I also noticed that I'm not very dependent on my hand expressions when I speak English as much as I am when I speak Spanish, probably because I am less fluent in Spanish and my vocabulary is aided by using hand expressions.

I think our physical and vocal expressions play a huge role in telling stories and communicating ideas, not only for adding to the context of what we are trying to say but especially to keep the other person or group interested in the conversation. Speaking in monotone would get boring pretty quickly because there is no life being added to the conversation. Without emotion, there is no telling when someone is angry or sad or anything that tells us the state of their being. It would not be enough to see a person crying if they couldnt express their words with some sort of variety in their vocal pitch. 

Piltdown Man

The Piltdown hoax occurred in the early 1900s in Sussex, England. Charles Dawson and Sir Arthur Smith Woodward had found a seemingly important collection of fossils that appeared to be real physical evidence that humans and apes were related by a common ancestor. The most telling piece of evidence that they found was the ape-like jawbone structure that contained human-like molars. The find also appeared to be definitive proof that the origins of modern humans did not begin in Africa but in England because the fossils were assumed to predate all other recorded early human fossils at the time, misleading scientists for many years about the origins of human evolution. The find was not exposed as a hoax until over 40 years later when newer findings conflicted with the Piltdown man and newer technology actually dated the fossils appropriately, and then it was finally realized that the fossils were in fact orangutan remains, made to look like prehistoric fossils.

Greed and ambition were likely the reasons that drove the masterminds of this hoax in order to earn more prestige and honor as scientists. There was also a kind of pressure on Britain to find early human remains since other European countries had already found many early man fossils in their own countries. At the time, Britain had not had any early human fossils to compete with those from Germany, France and Spain, but when Piltdown man was discovered Britain was finally able to claim their land as the birthplace of the entire human race. The greed and ambition of these lesser scientists led to a hoax that only misled the scientific community for multiple decades and validated ideas that were later proven to be incorrect. But the Piltdown man hoax was an event that taught the scientific community a lesson and forced scientists to become less vulnerable in accepting false evidence as truth.

As technologies evolved, scientists were eventually able to test the artifacts to figure out their age. It would not have been impossible to figure out much sooner that it was hoax if only its discoverers would have looked more closely and realized that the coloration of the fossils was unnatural and that the teeth had been deliberately filed down to look like human molars. As obvious as the hoax appears in hindsight, further tests were eventually made in which the fluoride levels in the teeth were measured, roughly estimating that the fossils were actually much younger than they were first claimed to be. Over time the Piltdown man fossils did not fit in with any of the other findings that were being discovered around the world, and it eventually conflicted so much that its invalidity would have been impossible to ignore forever.

It is probably not possible to remove the human factor from science since it is exactly that which drives us to become scientists in the first place. You simply cannot teach curiosity to a robot. We just have to accept the fact that there will always be those who try to lie and cheat their way to the top but if we just follow the scientific method and remain skeptical of everything, the truth will eventually become apparent.

I learned that competition between countries is the same as competition between two people. It is a primitive quality that belongs outside of science and that we must learn to shake if we want to ever learn to work together to find solutions to life’s greatest question: where do we come from? It is an honest question that begs an honest answer. We must strive to be as objective and thorough as possible when it comes to studying evidence and not take anything at face value. As a scientist, I would only be humiliating myself if I worked sloppily and if I allowed my selfish interests to keep me from being an objective observer.

Homologous vs Analogous Traits

Homologous Traits

The beaver is a semi-aquatic, broad-tailed mammal native to North America and Eurasia that builds dams for protection from predators and for easier access and storage of food. The elephant is the largest land mammal that is native to Africa and Asia; elephants are highly intelligent and live in matriarchs in which every year the oldest female leads the herd across many miles to the water sources that she remembers.

The teeth of a beaver and the tusks of an elephant are homologous traits because they are related features that have evolved from a common ancestor. Although they appear to be different structures they are both evolved from the incisor teeth that they shared in their common ancestor. Beaver teeth and elephant tusks have changed over time to perform different functions but they are both considered to be the incisor teeth in either animal.

Beaver teeth never stop growing and get continuously filed down as they get used throughout their lifespan. They mainly function to chew down trees for building dams and lodges. Elephant tusks also grow continuously and are used for digging, fighting, and carving tree bark for food. 

The common ancestor between the beaver and the elephant is believed to be Juramaia, a small, furry rodent that survived the apocalypse that killed the dinosaurs. This rodent has also been hypothesized to be the common ancestor to all mammals.

Analogous Traits

The octopus is a squishy invertebrate creature that has two eyes, three hearts and eight limbs, and lives deep in the ocean. The human is a vertebrate that lives completely on land and has two eyes, one heart, two arms and walks upright on two legs.

The eyes of the octopus and the eyes of a human are an analogous trait that is shared by both species but they evolved independently from each other out of the necessity for vision.

The anatomy of the human and octopus eyes may appear similar but function very differently. The human eye focuses on an object by changing the shape of the lens with the eye muscles, while the octopus protracts and retracts the lens to and from the retina, like a camera-lens. The nervous and cellular functions are also completely backwards and opposite between humans and the octopus, but it has to do with the fact that we evolved to see through air, and octopuses evolved to see through water, resulting in completely different types of eyes.

Our species is so different from the octopus that we may not appear related at all but somewhere in the timeline of evolution, we all still had to have shared the same common ancestor. The reason that the trait for eyes between humans and octopuses is analogous is because our common ancestor had not yet evolved eyes until after the evolutionary split occurred in the family tree. One branch that led to humans and the other that led to octopuses and somewhere in between the eyes evolved independently as a means of the necessity to survive, or in other words, from natural selection.

DNA

TACCACGTAAACGTTAATACGTATCACGCAAACGCTATGACCTTTATC

Charles Lyell

1. Of the five individuals listed I would argue that Charles Lyell had the most influenced over Darwin’s development of Natural Selection. Darwin’s idea that every adaptation for species survival were only passed on by random chance and over a uniform period of time was greatly inspired by the studies that Charles Lyell had already published.

2. http://www.pbs.org/wgbh/evolution/library/02/4/l_024_01.html
According to PBS, Charles Lyell's book Principles of Geology was the most important science book of all time. If you think about it, his observations and ideas about the slow and uniform growth of mountains was what inspired Charles Darwin to develop his theory of evolution as also a slow and uniform process in species. If Charles Lyell's book inspired Charles Darwin to come up with his theory then it definitely earns its title as "the most important scientific book ever."

3. The bullet point that most fits Lyell's positive influence for Darwin's theory of evolution must be the one that says "Individuals do not evolve. Populations do." According to PBS, Darwin applied what he learned from Lyell's geologic studies and realized that, like the valleys and mountains of the earth's crust, species also either evolve gradually or die out gradually.

4. Darwin probably could have come up with his theory of natural selection all by himself but he would have had to study geology to the extent as Lyell did so that he could be able to imagine how long it actually takes for evolution to occur, like how mountains grow only 10 inches in a whole decade, it is hard to imagine without that kind of comparison.

5. Darwin was a faithful person but he was also a scientist compelled to find the truth about his origins. He must have felt pressured to break it gently to the religious folks (which was everybody) but he needed to publish his findings as truthful as possible anyway. The church in those times was completely unforgiving because they had so much power, and Darwin was one among a quite a few just trying to find the truth.